LexicMap is a nucleotide sequence alignment tool for efficiently querying gene, plasmid, viral, or long-read sequences (>150 bp) against up to millions of prokaryotic genomes.
Documents: https://bioinf.shenwei.me/LexicMap
For the latest features and improvements, please download the pre-release binaries.
Preprint:
Wei Shen, John A. Lees, Zamin Iqbal. (2024) LexicMap: efficient sequence alignment against millions of prokaryotic genomes. bioRxiv. https://doi.org/10.1101/2024.08.30.610459
- LexicMap: efficient sequence alignment against millions of prokaryotic genomes​
- Table of contents
- Features
- Introduction
- Quick start
- Performance
- Installation
- Algorithm overview
- Citation
- Limitations
- Terminology differences
- Support
- License
- Related projects
- The accuracy of LexicMap is comparable with Blastn, MMseqs2, and Minimap2. It
- performs base-level alignment, with
qcovGnm
,qcovHSP
,pident
,evalue
andbitscore
returned, both in TSV and pairwise alignment format (output format).- provides a genome-wide query coverage metric (
qcovGnm
), which enables accurate interpretation of search results - particularly for circular queries (such as plasmid, virus, and mtDNA) against both complete and fragmented assemblies.
- provides a genome-wide query coverage metric (
- returns all possible matches, including multiple copies of a gene in a genome.
- performs base-level alignment, with
- The alignment is fast and memory-efficient, scalable to up to millions of prokaryotic genomes.
- LexicMap is easy to install, we provide binary files with no dependencies for Linux, Windows, MacOS (x86 and arm CPUs).
- LexicMap is easy to use (see tutorials, usages, and FAQs).
- Database building requires only a simple command, accepting input from files, a file list, or even a directory.
- Sequence searching supports limiting search by TaxId(s), provides a progress bar.
- Several utility commands are available to resume unfinished indexing, and explore the index data, extract indexed subsequences.
Motivation: Alignment against a database of genomes is a fundamental operation in bioinformatics, popularised by BLAST. However, given the increasing rate at which genomes are sequenced, existing tools struggle to scale.
- Existing full alignment tools face challenges of high memory consumption and slow speeds.
- Alignment-free large-scale sequence searching tools only return the matched genomes, without the vital positional information for downstream analysis.
- Mapping tools, or those utilizing compressed full-text indexes, return only the most similar matches.
- Prefilter+Align strategies have the sensitivity issue in the prefiltering step.
Methods: (algorithm overview)
- A rewritten and improved version of the sequence sketching method LexicHash is adopted to compute alignment seeds accurately and efficiently.
- We solved the sketching deserts problem of LexicHash seeds to provide a window guarantee.
- We added the support of suffix matching of seeds, making seeds much more tolerant to mutations. Any 31-bp seed with a common ≥15 bp prefix or suffix can be matched.
- A hierarchical index enables fast and low-memory variable-length seed matching (prefix + suffix matching).
- A pseudo alignment algorithm is used to find similar sequence regions from chaining results for alignment.
- A reimplemented Wavefront alignment algorithm is used for base-level alignment.
Results:
-
LexicMap enables efficient indexing and searching of both RefSeq+GenBank and the AllTheBacteria datasets (2.3 and 1.9 million prokaryotic assemblies respectively).
-
When searching in all 2,340,672 Genbank+Refseq prokaryotic genomes, Blastn is unable to run with this dataset on common servers as it requires >2000 GB RAM. (see performance).
With LexicMap v0.7.0 (48 CPUs),
Query Genome hits Genome hits
(high-similarity)Genome hits
(medium-similarity)Genome hits
(low-similarity)Time RAM A 1.3-kb marker gene 41,718 11,746 115 29,857 3m:06s 3.97 GB A 1.5-kb 16S rRNA 1,955,167 245,884 501,691 1,207,592 32m:59s 11.09 GB A 52.8-kb plasmid 560,330 96 15,370 544,864 52m:22s 14.48 GB 1003 AMR genes 30,967,882 7,636,386 4,858,063 18,473,433 15h:52m:08s 24.86 GB Notes:
- Default paramters are used, for returning all possible matches.
- Only the best alignment of a genome is used to evaluate alignment similarity:
- high-similarity: (a) qcov >= 90% (genes) or 70% (plasmids), (b) pident>=90%.
- medium-similarity: (a) not belong to high-similarity, (b) qcov >= 50% (genes) or 30% (plasmids), (c) pident>=80%.
- low-similarity: left.
- The search time varies in different computing environments and mainly depends on the I/O speed.
More documents: https://bioinf.shenwei.me/LexicMap.
Building an index (see the tutorial of building an index).
# From a directory with multiple genome files
lexicmap index -I genomes/ -O db.lmi
# From a file list with one file per line
lexicmap index -S -X files.txt -O db.lmi
Querying (see the tutorial of searching).
# For short queries like genes or long reads, returning top N hits.
lexicmap search -d db.lmi query.fasta -o query.fasta.lexicmap.tsv \
--min-qcov-per-hsp 70 --min-qcov-per-genome 70 --top-n-genomes 10000
# For longer queries like plasmids, returning all hits.
lexicmap search -d db.lmi query.fasta -o query.fasta.lexicmap.tsv \
--min-qcov-per-hsp 0 --min-qcov-per-genome 0 --top-n-genomes 0
Sample output (queries are a few Nanopore Q20 reads). See output format details.
query qlen hits sgenome sseqid qcovGnm cls hsp qcovHSP alenHSP pident gaps qstart qend sstart send sstr slen evalue bitscore
------------------ ---- ---- --------------- ----------------- ------- --- --- ------- ------- ------ ---- ------ ---- ------- ------- ---- ------- --------- --------
ERR5396170.1000004 190 1 GCF_000227465.1 NC_016047.1 84.211 1 1 84.211 165 89.091 5 14 173 4189372 4189536 - 4207222 1.93e-63 253
ERR5396170.1000006 796 3 GCF_013394085.1 NZ_CP040910.1 99.623 1 1 99.623 801 97.628 9 4 796 1138907 1139706 + 1887974 0.00e+00 1431
ERR5396170.1000006 796 3 GCF_013394085.1 NZ_CP040910.1 99.623 2 2 99.623 801 97.628 9 4 796 32607 33406 + 1887974 0.00e+00 1431
ERR5396170.1000006 796 3 GCF_013394085.1 NZ_CP040910.1 99.623 3 3 99.623 801 97.628 9 4 796 134468 135267 - 1887974 0.00e+00 1431
ERR5396170.1000006 796 3 GCF_013394085.1 NZ_CP040910.1 99.623 4 4 99.623 801 97.503 9 4 796 1768896 1769695 + 1887974 0.00e+00 1427
ERR5396170.1000006 796 3 GCF_013394085.1 NZ_CP040910.1 99.623 5 5 99.623 801 97.378 9 4 796 242012 242811 - 1887974 0.00e+00 1422
ERR5396170.1000006 796 3 GCF_013394085.1 NZ_CP040910.1 99.623 6 6 99.623 801 96.879 12 4 796 154380 155176 - 1887974 0.00e+00 1431
ERR5396170.1000006 796 3 GCF_013394085.1 NZ_CP040910.1 99.623 7 7 57.915 469 95.736 9 4 464 1280313 1280780 + 1887974 3.71e-236 829
ERR5396170.1000006 796 3 GCF_013394085.1 NZ_CP040910.1 99.623 8 8 42.839 341 99.120 0 456 796 1282477 1282817 + 1887974 6.91e-168 601
ERR5396170.1000006 796 3 GCF_009663775.1 NZ_RDBR01000008.1 99.623 1 1 99.623 801 93.383 9 4 796 21391 22190 - 52610 0.00e+00 1278
ERR5396170.1000006 796 3 GCF_003344625.1 NZ_QPKJ02000188.1 97.362 1 1 87.437 700 98.143 5 22 717 1 699 - 826 0.00e+00 1249
ERR5396170.1000006 796 3 GCF_003344625.1 NZ_QPKJ02000423.1 97.362 2 2 27.889 222 99.550 0 575 796 1 222 + 510 3.47e-106 396
ERR5396170.1000000 698 2 GCF_001457615.1 NZ_LN831024.1 92.264 1 1 92.264 656 96.341 13 53 696 4452083 4452737 + 6316979 0.00e+00 1169
ERR5396170.1000000 698 2 GCF_000949385.2 NZ_JYKO02000001.1 91.977 1 1 91.977 654 78.135 13 55 696 5638788 5639440 - 5912440 2.68e-176 630
ERR5396170.1000001 2505 3 GCF_000307025.1 NC_018584.1 67.066 1 1 67.066 1690 97.633 16 47 1726 1905511 1907194 - 2951805 0.00e+00 2985
ERR5396170.1000001 2505 3 GCF_900187225.1 NZ_LT906436.1 65.070 1 1 65.070 1641 93.723 20 95 1724 1869503 1871134 - 2864663 0.00e+00 2626
ERR5396170.1000001 2505 3 GCF_013394085.1 NZ_CP040910.1 30.858 1 1 30.858 780 97.692 9 1726 2498 183873 184650 + 1887974 0.00e+00 1384
ERR5396170.1000001 2505 3 GCF_013394085.1 NZ_CP040910.1 30.858 2 2 5.030 127 87.402 1 2233 2358 1236170 1236296 + 1887974 1.73e-37 167
ERR5396170.1000001 2505 3 GCF_013394085.1 NZ_CP040910.1 30.858 3 3 5.150 130 80.769 12 2233 2361 930381 930499 - 1887974 6.61e-43 185
ERR5396170.1000001 2505 3 GCF_013394085.1 NZ_CP040910.1 30.858 4 4 3.713 93 93.548 0 2257 2349 1104581 1104673 - 1887974 5.09e-30 141
CIGAR string, aligned query and subject sequences can be outputted as extra columns via the flag -a/--all
.
# Extracting similar sequences for a query gene.
# search matches with query coverage >= 90%
lexicmap search -d gtdb_complete.lmi/ b.gene_E_faecalis_SecY.fasta -o results.tsv \
--min-qcov-per-hsp 90 --all
# extract matched sequences as FASTA format
sed 1d results.tsv | awk -F'\t' '{print ">"$5":"$15"-"$16":"$17"\n"$23;}' \
| seqkit seq -g > results.fasta
seqkit head -n 1 results.fasta | head -n 3
>NZ_JALSCK010000007.1:39224-40522:-
TTGTTCAAGCTATTAAAGAACGCCTTTAAAGTCAAAGACATTAGATCAAAAATCTTATTT
ACAGTTTTAATCTTGTTTGTATTTCGCCTAGGTGCGCACATTACTGTGCCCGGGGTGAAT
Export blast-style format:
# here, we only align <=200 bp queries and show one low-similarity result.
$ seqkit seq -g -M 200 q.long-reads.fasta.gz \
| lexicmap search -d demo.lmi/ -a \
| csvtk filter2 -t -f '$pident >80 && $pident < 90' \
| csvtk head -t -n 1 \
| lexicmap utils 2blast --kv-file-genome ass2species.map
Query = GCF_003697165.2_r40
Length = 186
[Subject genome #1/2] = GCF_002950215.1 Shigella flexneri
Query coverage per genome = 93.548%
>NZ_CP026788.1
Length = 4659463
HSP cluster #1, HSP #1
Score = 279 bits, Expect = 9.66e-75
Query coverage per seq = 93.548%, Aligned length = 177, Identities = 88.701%, Gaps = 6
Query range = 13-186, Subject range = 1124816-1124989, Strand = Plus/Plus
Query 13 CGGAAACTGAAACA-CCAGATTCTACGATGATTATGATGATTTA-TGCTTTCTTTACTAA 70
|||||||||||||| |||||||||| | |||||||||||||||| |||||||||| ||||
Sbjct 1124816 CGGAAACTGAAACAACCAGATTCTATGTTGATTATGATGATTTAATGCTTTCTTTGCTAA 1124875
Query 71 AAAGTAAGCGGCCAAAAAAATGAT-AACACCTGTAATGAGTATCAGAAAAGACACGGTAA 129
|| |||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct 1124876 AA--GCAGCGGCCAAAAAAATGATTAACACCTGTAATGAGTATCAGAAAAGACACGGTAA 1124933
Query 130 GAAAACACTCTTTTGGATACCTAGAGTCTGATAAGCGATTATTCTCTCTATGTTACT 186
|| ||||||||| ||||| |||||||||||||||||||||||| |||| |||
Sbjct 1124934 AAAGACACTCTTTGAAGTACCTGAAGTCTGATAAGCGATTATTCTCTCCATGT-ACT 1124989
Learn more: demo, tutorials, or usages.
See the paper.
LexicMap is implemented in Go programming language, executable binary files for most popular operating systems are freely available in release page.
Or install with conda or pixi:
conda install -c bioconda lexicmap
We also provide pre-release binaries, with new features and improvements.
Wei Shen, John A. Lees, Zamin Iqbal. (2024) LexicMap: efficient sequence alignment against millions of prokaryotic genomes. bioRxiv. https://doi.org/10.1101/2024.08.30.610459
- The queries need to be longer than 100 bp, though some shorter one can also be aligned.
- LexicMap is slow for >1Mb queries, and the alignment might be fragmented.
- LexicMap is slow for batch searching with more than hundreds of queries. However, there are some ways to improve the search speed of lexicmap search, such as keeping the top N genome matches via
-n/--top-n-genomes
or storing the index on solid state drives (SSDs).
- In the LexicMap source code and command line options, the term "mask" is used, following the terminology in the LexicHash paper.
- In the LexicMap manuscript, however, we use "probe" as it is easier to understand. Because these masks, which consist of thousands of k-mers and capture k-mers from sequences through prefix matching, function similarly to DNA probes in molecular biology.
Please open an issue to report bugs, propose new functions or ask for help.
- High-performance LexicHash computation in Go.
- Wavefront alignment algorithm (WFA) in Golang.